Usage ============ Data preprocessing ------------------ Help :: python preprocessing -h usage: preprocessing.py [-h] [--genome GENOME] [--tss TSS] [--outdir OUTDIR] optional arguments: -h, --help show this help message and exit --genome GENOME, -g GENOME genome fasta --tss TSS, -t TSS tss path --outdir OUTDIR, -o OUTDIR outdir File format information * `genome` is a `fasta `_ format:: # fasta format head tair10.fa >Chr1 CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAA GCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTGGTTT * `TSS` is a table format file:: head cage_covered_5_leader.csv Chr1,+,AT1G01010.1,3624 Chr1,+,AT1G01010.1,3662 Chr1,-,AT1G01020.2,8720 Chr1,-,AT1G01020.6,8720 Chr1,-,AT1G01020.1,8720 Chr1,-,AT1G01020.3,8720 Chr1,-,AT1G01020.4,8720 Chr1,-,AT1G01020.5,8720 Example :: mkdir data_cage_covered; python preprocessing.py -g ../../tair10.fa \ -t cage_covered_5_leader.csv \ -o data_cage_covered `gffutils` is `tested `_ with Python 3.6, 3.7, 3.8, 3.9. Model training --------------------- * Ray 1.13.0 (Hyperparameters optimization) * batch size * leanring rate `TSARC`:: python trainTSARC.py -h usage: testTSARC.py [-h] [--model {lr,cnn,gru,lstm,attention}] [--test_data_path TEST_DATA_PATH] [--test_label_path TEST_LABEL_PATH] [--model_dict_path MODEL_DICT_PATH] PyTorch Implementation of TSAR Predict optional arguments: -h, --help show this help message and exit --model {lr,cnn,gru,lstm,attention} model name --test_data_path TEST_DATA_PATH test data saved in numpy ndarry --test_label_path TEST_LABEL_PATH test label saved in numpy ndarray --model_dict_path MODEL_DICT_PATH model saved name Example :: python trainTSARC.py --model ResNet \ --train_data_path ../../data_cage_covered/class_data.npy \ --train_label_path ../../data_cage_covered/class_label.npy \ --lr 0.001 --batch_size 128 \ --model_save saved_model --epoch 100 `TSARL`:: usage: testTSARL.py [-h] [--model {cnn,gru,attention}] [--test_data_path TEST_DATA_PATH] [--test_label_path TEST_LABEL_PATH] [--scaler SCALER] [--model_dict_path MODEL_DICT_PATH] PyTorch Implementation of TSAR Predict optional arguments: -h, --help show this help message and exit --model {cnn,gru,attention} model name --test_data_path TEST_DATA_PATH test data saved in numpy ndarry --test_label_path TEST_LABEL_PATH test label saved in numpy ndarray --scaler SCALER scaler for test data scale --model_dict_path MODEL_DICT_PATH model saved name Example :: python trainTSARL.py --model ResNet \ --train_data_path ../data/regress_data.npy \ --train_label_path ../data/regress_label.npy \ --lr 0.001 --batch_size 128 \ --model_saved saved_model --epoch 200 Model predicting ---------------- `TSARC`:: conda install --channel conda-forge --channel bioconda numpy pandas biopython scikit-learn torch usage: predictTSARC.py [-h] [--model_id {lr,cnn,gru,lstm,attention,resnet}] [--input_path INPUT_PATH] [--output_path OUTPUT_PATH] [--model_path MODEL_PATH] PyTorch Implementation of TSARC Predict optional arguments: -h, --help show this help message and exit --model_id {lr,cnn,gru,lstm,attention,resnet} model name --input_path INPUT_PATH input data csv --output_path OUTPUT_PATH output path --model_path MODEL_PATH model saved name `TSARL`:: python predictTSARL.py -h usage: predictTSARL.py [-h] [--model_id {lr,cnn,gru,lstm,attention,resnet}] [--input_path INPUT_PATH] [--output_path OUTPUT_PATH] [--model_path MODEL_PATH] PyTorch Implementation of TSARL Predict optional arguments: -h, --help show this help message and exit --model_id {lr,cnn,gru,lstm,attention,resnet} model name --input_path INPUT_PATH input data csv --output_path OUTPUT_PATH output path --model_path MODEL_PATH model saved name